Home    Target List    Selection    Community Requests    Clones    Screenings    XML files    Diffraction Images    Progress    Homolog Search    Clustering    Statistics    News    Help    Log In

Clone

Target
IDP91779  
Clone Suffix
205
Sequence Comments
mutation: Q104A  
Experiment Start Date
Dec 07, 2011  
Experiment End Date
 
Person
Veronica Yim  
Lab
University of Toronto  
Protocol ID
Cloning_protocol_Toronto  
Status
success  
Vector
p15Tv lic  
Sequence Start
1  
Sequence End
162  
Reference Sequence Used
MKNNNVTEKE LFYILDLFEH MKVTYWLDGG WGVDVLTGKQ QREHRDIDID FDAQHTQKVI QKLEDIGYKI EVHWMPSRME LKHEEYGYLD IHPINLNDDG SITQANPEGG NYVFQNDWFS ETNYKDRKIP CISKEAQLLF HSGYDLTETD HFDIKNLKSI T  
PCR Forward Primer
TTGTATTTCCAGGGCATGAAAAATAATAATGTAACAGAAAAAG  
PCR Backward Primer
CAAGCTTCGTCATCATGTTATTGATTTTAAATTTTTTATATC