Home    Target List    Selection    Community Requests    XML files    Diffraction Images    Homolog Search    Clustering    CheckMyMetal Server    Statistics    Screenings    Progress    Clones    News    Help    Log In

Clone

Target
IDP91779  
Clone Suffix
210
Sequence Comments
mutation: F114A  
Experiment Start Date
Dec 07, 2011  
Experiment End Date
 
Person
Veronica Yim  
Lab
University of Toronto  
Protocol ID
Cloning_protocol_Toronto  
Status
success  
Vector
p15Tv lic  
Sequence Start
1  
Sequence End
162  
Reference Sequence Used
MKNNNVTEKE LFYILDLFEH MKVTYWLDGG WGVDVLTGKQ QREHRDIDID FDAQHTQKVI QKLEDIGYKI EVHWMPSRME LKHEEYGYLD IHPINLNDDG SITQANPEGG NYVFQNDWFS ETNYKDRKIP CISKEAQLLF HSGYDLTETD HFDIKNLKSI T  
PCR Forward Primer
TTGTATTTCCAGGGCATGAAAAATAATAATGTAACAGAAAAAG  
PCR Backward Primer
CAAGCTTCGTCATCATGTTATTGATTTTAAATTTTTTATATC