Clone

Target
IDP91779  
Clone Suffix
219
Experiment Start Date
Aug 30, 2011  
Experiment End Date
 
Person
Marina Kudritska  
Lab
University of Toronto  
Protocol ID
Cloning_protocol_Toronto  
Status
success  
Vector
p15Tv lic  
Sequence Start
1  
Sequence End
109  
Reference Sequence Used
MKNNNVTEKE LFYILDLFEH MKVTYWLDGG WGVDVLTGKQ QREHRDIDID FDAQHTQKVI QKLEDIGYKI EVHWMPSRME LKHEEYGYLD IHPINLNDDG SITQANPEG  
PCR Forward Primer
TTGTATTTCCAGGGCATGAAAAATAATAATGTAACAGAAAAAG  
PCR Backward Primer
CAAGCTTCGTCATCAACCTTCTGGGTTTGCTTGGG