Home    Target List    Selection    Community Requests    Clones    Screenings    XML files    Diffraction Images    Progress    Homolog Search    Clustering    Statistics    News    Help    Log In

Clone

Target
IDP91779  
Clone Suffix
219
Experiment Start Date
Aug 30, 2011  
Experiment End Date
 
Person
Marina Kudritska  
Lab
University of Toronto  
Protocol ID
Cloning_protocol_Toronto  
Status
success  
Vector
p15Tv lic  
Sequence Start
1  
Sequence End
109  
Reference Sequence Used
MKNNNVTEKE LFYILDLFEH MKVTYWLDGG WGVDVLTGKQ QREHRDIDID FDAQHTQKVI QKLEDIGYKI EVHWMPSRME LKHEEYGYLD IHPINLNDDG SITQANPEG  
PCR Forward Primer
TTGTATTTCCAGGGCATGAAAAATAATAATGTAACAGAAAAAG  
PCR Backward Primer
CAAGCTTCGTCATCAACCTTCTGGGTTTGCTTGGG