Home    Target List    Selection    Community Requests    XML files    Diffraction Images    Homolog Search    Clustering    CheckMyMetal Server    Statistics    Screenings    Progress    Clones    News    Help    Log In

Clone

Target
IDP04396  
Clone Suffix
1 - The clone is available in BEIR but it is out of stock.
Experiment Start Date
Nov 17, 2009  
Experiment End Date
Nov 30, 2009  
Person
Sarah Grimshaw  
Lab
J. Craig Venter Institute  
Protocol ID
CSG-003_PCR Amplification and Ligation Independent Cloning (LIC)  
Status
success  
Vector
pMCSG7  
Sequence Start
1  
Sequence End
331  
Reference Sequence Used
MKVAENQKVY DITIIGGGPT GLFTAFYGGM RQASVKIIES LPQLGGQLSA LYPEKYIYDV AGFPKVRAQE LVDNLKEQMK KFDPTVCLEE AVDTLEKQAD GIFKLVTNKQ THYSKSVIIT AGNGAFQPRR LELEGTAKYE KKNLHYFVDD MNKFAGKRVV VFGGGDSAVD WTMMLEPIAD KVTIVHRRDK FRAHEHSVES LMNSRAEVST PYVPVELIGD DKIEQVVLQH VKTEEKIIID VDDVIVNYGF VSSLGPIKNW GLDIQKNSIL VNSKMETNIP GIYAAGDICT YEGKVKLIAC GFGEAPTAVN NAKAYFDPNA KLQPMHSSSM F  
Reference Sequence Variance
MATCH  
Confirmed Protein Sequence
MKVAENQKVY DITIIGGGPT GLFTAFYGGM RQASVKIIES LPQLGGQLSA LYPEKYIYDV AGFPKVRAQE LVDNLKEQMK KFDPTVCLEE AVDTLEKQAD GIFKLVTNKQ THYSKSVIIT AGNGAFQPRR LELEGTAKYE KKNLHYFVDD MNKFAGKRVV VFGGGDSAVD WTMMLEPIAD KVTIVHRRDK FRAHEHSVES LMNSRAEVST PYVPVELIGD DKIEQVVLQH VKTEEKIIID VDDVIVNYGF VSSLGPIKNW GLDIQKNSIL VNSKMETNIP GIYAAGDICT YEGKVKLIAC GFGEAPTAVN NAKAYFDPNA KLQPMHSSSM F  
PCR Forward Primer
TACTTCCAATCCAATGCGATGAAAGTGGCAGAAAATCAAAA  
PCR Backward Primer
TTATCCACTTCCAATGTTAAAACATACTAGAGCTGTGC  
Shipped To Lab
ANL  
Shipped Date
Dec 29, 2009  
Inserted
Dec 03, 2009